Golodirsen API Manufacturer in India

Swapnroop Pharma · WHO-GMP Certified · +91 87670 62101

Golodirsen API Manufacturer in India

Golodirsen is an antisense oligonucleotide of the phosphorodiamidate morpholino oligomer (PMO) class. It is designed to promote exon 53 skipping of the dystrophin pre-mRNA and is used for the treatment of Duchenne muscular dystrophy (DMD) in patients with mutations amenable to exon 53 skipping. The product is marketed as VYONDYS 53. FDA approved golodirsen in December 2019 for this specific indication.

Golodirsen consists of 25 linked morpholino subunits. Unlike conventional DNA and RNA molecules, PMOs contain morpholino rings connected through uncharged phosphorodiamidate linkages. The base sequence of golodirsen is GTTGCCTCCGGTTCTGAAGGTGTTC.

Golodirsen Chemical Information

Golodirsen has the molecular formula C305H481N138O112P25 and a molecular weight of approximately 8647.28 Da. The CAS Number associated with golodirsen is 1422959-91-8, and its UNII is 033072U4MZ.

Golodirsen is supplied as an oligonucleotide drug substance and can also be handled in its sodium form. Supplier analytical information describes golodirsen sodium as a white to off-white solid.

Golodirsen API Specifications

Quality control of golodirsen requires analytical techniques appropriate for antisense oligonucleotides rather than only conventional small-molecule API tests. FDA documentation identifies important quality attributes including identity, molecular weight, assay, purity, specified impurities, elemental impurities and other product quality characteristics. Analytical methods include chromatographic and mass-spectrometric techniques.

The identity of the oligonucleotide can be confirmed through orthogonal analytical methods including mass spectrometry, LC and other suitable structural characterization techniques. FDA's guidance for golodirsen also highlights control of the primary sequence, chemical structure and diastereomeric composition.

Applications of Golodirsen

Golodirsen is an antisense therapeutic designed for exon 53 skipping in the DMD gene. It is intended for patients with Duchenne muscular dystrophy whose mutations are amenable to exon 53 skipping. FDA lists VYONDYS 53 (golodirsen) as an approved product for this indication.

Golodirsen Manufacturing

Manufacturing of golodirsen involves controlled oligonucleotide synthesis followed by purification and extensive analytical characterization. Because PMOs contain multiple phosphorodiamidate linkages, control of sequence, molecular mass and diastereomeric composition is important for consistent product quality. FDA specifically recommends appropriate analytical controls for these characteristics.

Key Features of Golodirsen API

  • Antisense oligonucleotide
  • Phosphorodiamidate morpholino oligomer (PMO)
  • CAS Number: 1422959-91-8
  • Molecular Formula: C305H481N138O112P25
  • Molecular Weight: 8647.28 Da
  • 25 linked morpholino subunits
  • Base sequence: GTTGCCTCCGGTTCTGAAGGTGTTC
  • Exon 53 skipping therapeutic
  • Used in Duchenne muscular dystrophy research and pharmaceutical applications
  • Requires specialized oligonucleotide analytical characterization

Storage

Golodirsen material should be stored according to the validated manufacturer specification and handling requirements. Commercial research material is commonly supplied as a solid and may require −20°C storage under nitrogen and protection from moisture, depending on the specific material and supplier.

Conclusion

Golodirsen is a specialized antisense oligonucleotide API belonging to the PMO class. Its defined 25-subunit sequence and molecular structure make accurate identity, molecular-weight determination, purity assessment and control of oligonucleotide-related impurities important aspects of quality evaluation. FDA documentation provides detailed analytical considerations for golodirsen drug substance and drug product.

Detailed Specifications

Parameter Specification
Appearance White to off-white crystalline powder
Identification IR & HPLC compliant
Assay (HPLC) ≥99.0%
Loss on Drying NMT 0.5%
Individual Impurity NMT 1.0%
Total Impurities NMT 2.0%
Water Content NMT 0.5%
Get Bulk Quote via WhatsApp